dbsnp.clinvar_variant_xrefs

Python

In [1]:

import bedrock_bio as bb

rel = bb.load_table('dbsnp.clinvar_variant_xrefs')
rel = rel.filter("assembly_accession = 'GCF_000001405.25' AND chromosome = '1'")

df = rel.limit(5).pl()  # Polars
df = rel.limit(5).df()  # Pandas
df.head()

Out[1]:

	sources	build	assembly_accession	assembly_name	chromosome	position	ref_allele	alt_allele	rsid	xref_source	xref_id
0	[{'url': 'https://ftp.ncbi.nlm.nih.gov/snp/arc...	b157	GCF_000001405.25	GRCh37.p13	1	871246	G	GGCAGCCTGGAGATTGGCCT	rs2100330388	Invitae	9996417
1	[{'url': 'https://ftp.ncbi.nlm.nih.gov/snp/arc...	b157	GCF_000001405.25	GRCh37.p13	1	874778	GCCTCCCCAGCCACGGTGAGGACCCACCCTGGCATGATCCCCCTCATCA	G	rs568340123	Invitae	1680099
2	[{'url': 'https://ftp.ncbi.nlm.nih.gov/snp/arc...	b157	GCF_000001405.25	GRCh37.p13	1	874778	GCCTCCCCAGCCACGGTGAGGACCCACCCTGGCATGATCCCCCTCATCA	GCCTCCCCAGCCACGGTGAGGACCCACCCTGGCATGATCCCCCTCA...	rs568340123	Invitae	1613992
3	[{'url': 'https://ftp.ncbi.nlm.nih.gov/snp/arc...	b157	GCF_000001405.25	GRCh37.p13	1	874778	GCCTCCCCAGCCACGGTGAGGACCCACCCTGGCATGATCCCCCTCATCA	GCCTCCCCAGCCACGGTGAGGACCCACCCTGGCATGATCCCCCTCA...	rs568340123	Invitae	3807250
4	[{'url': 'https://ftp.ncbi.nlm.nih.gov/snp/arc...	b157	GCF_000001405.25	GRCh37.p13	1	874816	CCCCCTCATCACCTCCCCAGCCACGGTGAGGACCCACCCTGGCATG...	C	rs745625383	Invitae	2361319

R

In [1]:

library(bedrockbio)
library(dplyr)

lf <- load_table("dbsnp.clinvar_variant_xrefs")
df <- filter(lf, assembly_accession == "GCF_000001405.25", chromosome == "1") |> collect()

head(df)

Out[1]:

Sample output (5 rows, showing 8 of 11 columns)
   assembly_accession | chromosome | build | assembly_name | position | ref_allele               | alt_allele               | rsid
   ------------------ | ---------- | ----- | ------------- | -------- | ------------------------ | ------------------------ | ------------
0  GCF_000001405.25   | 1          | b157  | GRCh37.p13    | 871246   | G                        | GGCAGCCTGGAGATTGGCCT     | rs2100330388
1  GCF_000001405.25   | 1          | b157  | GRCh37.p13    | 874778   | GCCTCCCCAGCCACGGTGAGGAC… | G                        | rs568340123
2  GCF_000001405.25   | 1          | b157  | GRCh37.p13    | 874778   | GCCTCCCCAGCCACGGTGAGGAC… | GCCTCCCCAGCCACGGTGAGGAC… | rs568340123
3  GCF_000001405.25   | 1          | b157  | GRCh37.p13    | 874778   | GCCTCCCCAGCCACGGTGAGGAC… | GCCTCCCCAGCCACGGTGAGGAC… | rs568340123
4  GCF_000001405.25   | 1          | b157  | GRCh37.p13    | 874816   | CCCCCTCATCACCTCCCCAGCCA… | C                        | rs745625383

Description

External variant identifiers associated with ClinVar records.

These identifiers describe the variant, not a ClinVar accession.

OMIM values are allelic variant numbers, distinct from the disease MIM numbers in clinvar_disease_xrefs.

Partitions

• assembly_accession
  • 'GCF_000001405.25'
  • 'GCF_000001405.40'
• chromosome
  • '1'
  • '10'
  • '11'
  • '12'
  • '13'
  • '14'
  • '15'
  • '16'
  • '17'
  • '18'
  • '19'
  • '2'
  • '20'
  • '21'
  • '22'
  • '3'
  • '4'
  • '5'
  • '6'
  • '7'
  • '8'
  • '9'
  • 'MT'
  • 'X'
  • 'Y'

Schema

Column	Type	Description
sources	STRUCT(url TEXT, filename TEXT, last_modified_at TIMESTAMPTZ, sha256 TEXT)[]	Source provenance for the row.
build	TEXT	dbSNP build version (e.g. b157).
assembly_accession	TEXT	Partition column. Versioned RefSeq assembly accession (GCF) for the variant coordinates.
assembly_name	TEXT	Exact NCBI assembly name, including its patch release (for example, GRCh38.p14).
chromosome	TEXT	Partition column. Chromosome on which the variant is located (1-22, X, Y, MT).
position	INT	Variant position within the chromosome (1-based).
ref_allele	TEXT	Reference allele.
alt_allele	TEXT	Alternate allele.
rsid	TEXT	NCBI RefSNP identifier.
xref_source	TEXT	Organization or database that maintains the identifier (e.g. OMIM, UniProtKB, or a submitting laboratory).
xref_id	TEXT	Identifier of the variant in that source.